HW#20#21

.pdf

School

University of Texas *

*We aren’t endorsed by this school

Course

325

Subject

Biology

Date

Dec 6, 2023

Type

pdf

Pages

Uploaded by ProfToadPerson979 on coursehero.com

Homework for Lecture #20 & #21 From Textbook Chapter 12 1. Problems #33 2. Problems #38 3. Problems #40 From Textbook Chapter 24 4. Problems #8 5. Problems #11 6. Problems #18 Additional Problems 7. Two wild-type alleles, 1 and 2, are present in a population in Hardy-Weinberg equilibrium and together make up 80% of the allele frequency at that locus. Homozygotes for allele 1 represent 9% of the population. What fraction of the population is heterozygous for allele 1 and 2? 8. You run a forensics department in a city with the population of 1 million. Your new employee made a mistake and could not get the result from 9 of 13 CODIS loci from a prime suspect. You stepped in and managed to get the result from 4 CODIS loci with match probability for each locus. How many people in your city would have the same genotypes as the prime suspect? Can you still use this result as a sole evidence to incriminate the prime suspect? 9-11. The following sequence is the TPOX locus with repeats microsatellites, one of the 13 CODIS loci. Locus D3S1358 vWA FGA D8S1179 Genotype 15, 18 16, 16 19, 24 12, 13 Match probability 8.2% 4.4% 1.7% 9.9% 5’ - GCATTTCAGGATCCAGTAGCATGAATGAATGAATGAATGAATGAATGAATGAA TGAATGAATGAATCCCAGACTGCAGTCAGTGCGACCG - 3’ 9. Identify the repeat motif of the TPOX locus (repeated regions are underlined). 10. Design a pair of 20 nucleotide long PCR primers that will amplify the TPOX locus (from the beginning to the end of given sequences). 11. Three alleles of the TPOX locus exist in the human population: 6-repeats

( TPOX 6 ), 8-repeats ( TPOX 8 ), or 11-repeats ( TPOX 11 ). Predict the size of the PCR product for each allele. Answer keys) 7. frequency of allele 1 = p; frequency of allele 2 = q p 2 =0.09,p=0.3p+q=0.8,q=0.5 Frequency of heterozygous = 2pq = 2 X 0.3 X 0.5 = 0.3 8. 0.082 X 0.044 X 0.017 X 0.099 X 1,000,000 = 6.0722; 6-7 people; No. 9. GAAT (or ATGA or TGAA) 10. 5’GCATTTCAGGATCCAGTAGC3’ 5’CGGTCGCACTGACTGCAGTC3’ 11. 46 + 4x6 = 70bp; 46 + 4x8 = 78bp; 46 + 4x11 = 90bp 4. You have a piece of DNA that includes the sequence: 5'- GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTT CAGT- 3' To amplify this DNA by PCR you would use a pair of primers with 10 nucleotide long per each. 5. The following sequence is a sequence of “RNA - like strand” from cDNA sequence for a gene called CLAVATA3 from the start code to the stop code . You wish to obtain the last 20 amino acid of this protein by constructing recombinant DNA. Recombinant DNA also needs to include the stop code to specify the end of protein synthesis. Design a pair of PCR primers (each with 15 nucleotides; indicate the polarity (5’ 3’)) to amplify DNA fragment that is suitable for your plan. 1 ATGGATTCGA AGAGTTTTCT GCTACTACTA CTACTCTTCT GCTTCTTGTT 51 CCTTCATGAT GCTTCTGATC TCACTCAAGC TCATGCTCAC GTTCAAGGAC 101 TTTCCAACCG CAAGATGATG ATGATGAAAA TGGAAAGTGA ATGGGTTGGA 151 GCAAATGGAG AAGCAGAGAA GGCAAAGACG AAGGGTTTAG GACTACATGA 201 AGAGTTAAGG ACTGTTCCTT CGGGACCTGA CCCGTTGCAC CATCATGTGA 251 ACCCACCAAG ACAGCCAAGA AACAACTTTC AGCTCCCTTG A

6-7. A hypothetical disorder called G syndrome is an autosomal dominant disease characterized by visual, skeletal, and cardiovascular defects. The disorder appears in middle age. Because its symptoms are variable, this disorder is difficult to diagnose. Early diagnose is important because the cardiovascular defects can be treated if the disorder is recognized early. The gene for G syndrome is known to reside in chromosome 7, and it is closely linked to two minisatellite polymorphism loci on the same chromosomes, one at A locus and one at the C locus. The G , A and C loci are very close together, and there is little crossing over between them. The following minisatellite alleles are found at the A and C loci: A locus: A1, A2, A3 ; C locus: C1, C2, C3 Sally, shown in the following pedigree, is concerned that she might have G syndrome. Her deceased mother had G syndrome, and she has a brother with the disorder. Her other brother is middle-aged and does not have the disease; so assume that he does not carry genes for it. A geneticist genotypes Sally and her immediate family for the A and C loci and obtains the genotypes shown on the pedigree. 6. Assume that there is no crossing over between the A , C , and G loci. Does Sally carry the gene that causes G syndrome? Explain why or why not? 7. Draw arrangement of the A, C, and G alleles on the chromosomes for all members of the family on the pedigree. 8. Assume that human genome is 3 billion base pair. What is the minimum length of PCR primer to ensure the specificity? 9. The following genomic DNA sequence (from RefSeq) is part of the RNA-like strand of the Huntingtin gene ( HD ) on human chromosome 4. The first base of the sequence shown is the beginning of the first exon. Recall that the HD gene is a trinucleotide repeat gene. The repeats (CAG codons) are underlined. You want to PCR-amplify the CAG-repeat region of the HD alleles in your genomic DNA so that by gel electrophoresis of the amplification products, you can determine the CAG-repeat number in each of your alleles. Design a primer pair that you can use to accomplish the amplification. [20 nt in length for both primers]

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version